SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to glycosyltransferase
42.46 kDa
protein length
384 aa Sequence Blast
gene length
1155 bp Sequence Blast
[SW|biofilm formation]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Matrix polysaccharide synthesis]
  • Gene

    3,523,270 → 3,524,424

    The protein

    Protein family

  • [SW|glycosyltransferase 1 family] (according to UniProt)
  • [SW|Glycosyltransferase 4 subfamily] (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
  • view in new tab

    Biological materials


  • MGNA-A069 (yveP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34320 (Δ[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACATGGAGCACGCGCTTTT, downstream forward: _UP4_AGCACGGAAAAGGACCATAA
  • BKK34320 (Δ[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACATGGAGCACGCGCTTTT, downstream forward: _UP4_AGCACGGAAAAGGACCATAA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • References


  • 20735481
  • The EAR [SW|RNA switch]

  • 20374491,20230605