SubtiBank SubtiBank
cotM
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotM

spore coat protein (outer)
locus
BSU_17970
pI
3.94
mw
15.08 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
function
resistance of the spore
product
spore coat protein (outer)
essential
no
synonyms
yneL

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.2|Class II]
  • Gene

    Coordinates
    1,925,655 → 1,926,047

    The protein

    [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|DB8DC5B305DB5F301B047A2CA2089EC6485E7109|cotM]
    description
    [Pubmed|9068633]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|9068633], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|9068633], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836,9068633]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yneK]' and '[protein|search|cotM]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE17970 (Δ[gene|DB8DC5B305DB5F301B047A2CA2089EC6485E7109|cotM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAACCTTGCTTTACA, downstream forward: _UP4_TAAACATAAAAAGTCACTTT
  • BKK17970 (Δ[gene|DB8DC5B305DB5F301B047A2CA2089EC6485E7109|cotM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAACCTTGCTTTACA, downstream forward: _UP4_TAAACATAAAAAGTCACTTT
  • References

    Reviews

  • 23202530
  • Original publications

  • 11150673,9068633,20525796,15383836,22171814,28870294