SubtiBank SubtiBank
spoIVB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoIVB

serine protease (site 1 protease), cleaves [protein|AB2A3422277040107AAF90358BBE58608F8E0738|SpoIVFA] to prepare it for [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB] cleavage, this results in pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK] processing/activation in the mother-cell, does also cleave [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB]
locus
BSU_24230
pI
8.84
mw
45.81 kDa
protein length
426 aa Sequence Blast
gene length
1281 bp Sequence Blast
function
control of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK] activation
product
serine protease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,519,102 → 2,520,382

    The protein

    Catalyzed reaction/ biological activity

  • Self-cleaves 52-Val-|-Asn-53, 62-Ala-|-Phe-63 and 74-Val-|-Thr-75 at the N-terminus of SpoIVB (according to UniProt)
  • Protein family

  • PDZ protease [Pubmed|24243021]
  • [SW|Domains]

  • [SW|PDZ domain] (aa 101 - 187) (according to UniProt)
  • Peptidase S55 domain (aa 188-426) (according to UniProt)
  • [SW|Localization]

  • secreted from the forespore to the intracellular space between the mother cell and the forespore [Pubmed|24243021]
  • Expression and Regulation

    Operons

    genes
    [gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]
    description
    [Pubmed|2106508]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,9004507], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,9004507], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG], [SW|SpoVT]) [Pubmed|16497325,15699190,9004507,8755877]
  • view in new tab

    Biological materials

    Mutant

  • BKE24230 (Δ[gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTACTTCACTCTCC, downstream forward: _UP4_TGACTGCCGGAGTTTCCGGC
  • BKK24230 (Δ[gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTACTTCACTCTCC, downstream forward: _UP4_TGACTGCCGGAGTTTCCGGC
  • labs

  • Simon Cutting, London, UK [http://personal.rhul.ac.uk/uhba/009/bacillus/simon_cutting.html homepage]
  • References

    Reviews

  • 31350897
  • Original Publications

  • 17493131,2106508,10931284,14526016,10931291,1900494,11418578,15292188,9004507,12940997,11741860,16497325,8755877,24243021,15292188,17557826,16818230,30403663