SubtiBank SubtiBank
spoIVB
The papers of the month are back! Check them out! Link here

spoIVB

serine protease, cleaves SpoIVFA to prepare it for CtpB cleavage, this results in pro-SigK processing/activation in the mother-cell, does also cleave CtpB
locus
BSU24230
pI
8.84
mw
45.81 kDa
protein length
425 aa Sequence Blast
gene length
1275 bp Sequence Blast
function
control of SigK activation
product
serine protease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,519,102 → 2,520,382

    The protein

    Catalyzed reaction/ biological activity

  • Self-cleaves 52-Val-|-Asn-53, 62-Ala-|-Phe-63 and 74-Val-|-Thr-75 at the N-terminus of SpoIVB (according to Swiss-Prot)
  • Protein family

  • PDZ protease [Pubmed|24243021]
  • [SW|Localization]

  • intracellular space between the mother cell and the forespore [Pubmed|24243021]
  • Expression and Regulation

    Operons

    genes
    [gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]
    description
    [Pubmed|2106508]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,9004507], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,9004507], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG], [SW|SpoVT]) [Pubmed|16497325,15699190,9004507,8755877]
  • view in new tab

    Biological materials

    Mutant

  • BKE24230 (Δ[gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTACTTCACTCTCC, downstream forward: _UP4_TGACTGCCGGAGTTTCCGGC
  • BKK24230 (Δ[gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTACTTCACTCTCC, downstream forward: _UP4_TGACTGCCGGAGTTTCCGGC
  • Labs working on this gene/protein

  • Simon Cutting, London, UK [http://personal.rhul.ac.uk/uhba/009/bacillus/simon_cutting.html homepage]
  • References

  • 17493131,2106508,10931284,14526016,10931291,1900494,11418578,15292188,9004507,12940997,11741860,16497325,8755877,24243021,15292188,17557826,16818230