SubtiBank SubtiBank
spoIVB
The papers of the month are back! Check them out! Link here

spoIVB

serine protease, cleaves [protein|AB2A3422277040107AAF90358BBE58608F8E0738|SpoIVFA] to prepare it for [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB] cleavage, this results in pro-[protein|search|SigK] processing/activation in the mother-cell, does also cleave [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB]
locus
BSU24230
pI
8.84
mw
45.81 kDa
protein length
425 aa Sequence Blast
gene length
1275 bp Sequence Blast
function
control of [protein|search|SigK] activation
product
serine protease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,519,102 → 2,520,382

    The protein

    Catalyzed reaction/ biological activity

  • Self-cleaves 52-Val-|-Asn-53, 62-Ala-|-Phe-63 and 74-Val-|-Thr-75 at the N-terminus of SpoIVB (according to Swiss-Prot)
  • Protein family

  • PDZ protease [Pubmed|24243021]
  • [SW|Domains]

  • signal peptide (aa 1 - 28) (according to UniProt)
  • propeptide (aa 29 - 52) (according to UniProt)
  • [SW|PDZ domain] (aa 101 - 187) (according to UniProt)
  • [SW|Localization]

  • intracellular space between the mother cell and the forespore [Pubmed|24243021]
  • Expression and Regulation

    Operons

    genes
    [gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]
    description
    [Pubmed|2106508]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,9004507], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,9004507], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG], [SW|SpoVT]) [Pubmed|16497325,15699190,9004507,8755877]
  • view in new tab

    Biological materials

    Mutant

  • BKE24230 (Δ[gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTACTTCACTCTCC, downstream forward: _UP4_TGACTGCCGGAGTTTCCGGC
  • BKK24230 (Δ[gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTACTTCACTCTCC, downstream forward: _UP4_TGACTGCCGGAGTTTCCGGC
  • Labs working on this gene/protein

  • Simon Cutting, London, UK [http://personal.rhul.ac.uk/uhba/009/bacillus/simon_cutting.html homepage]
  • References

  • 17493131,2106508,10931284,14526016,10931291,1900494,11418578,15292188,9004507,12940997,11741860,16497325,8755877,24243021,15292188,17557826,16818230