SubtiBank SubtiBank
gerKD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gerKD

negative effector (D protein) of the [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|GerKA]-[protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|GerKB]-[protein|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|GerKC] germinant receptor
locus
BSU_03690
pI
10.01
mw
8.25 kDa
protein length
gene length
222 bp Sequence Blast
function
germination
product
negative effector of the [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|GerKA]-[protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|GerKB]-[protein|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|GerKC] germinant receptor
essential
no
synonyms
yczF

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.1|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    419,763 → 419,984

    Phenotypes of a mutant

  • faster [SW|germination] with the AGFK germinant mixture [Pubmed|23625846]
  • higher sensitivity to AGFK germinants ([SW|germination] at lower concentrations) [Pubmed|23625846]
  • The protein

    [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F|gerKD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|23625846], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore ([protein|search|SigG]) [Pubmed|23625846]
  • view in new tab

    Biological materials

    Mutant

  • BKE03690 (Δ[gene|DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F|gerKD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCATCATCCTCCGC, downstream forward: _UP4_AACCCCTAAAGGGGGGCGCT
  • BKK03690 (Δ[gene|DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F|gerKD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCATCATCCTCCGC, downstream forward: _UP4_AACCCCTAAAGGGGGGCGCT
  • References

  • 23625846,22383849,27766092