SubtiBank SubtiBank
yybD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yybD

similar to GCN5-related N-acetyltransferase
locus
BSU_40680
pI
6.16
mw
16.42 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,181,456 → 4,181,899

    The protein

    Protein family

  • UPF0039 (ElaA) family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|AD0F95A25190DA7E253F4C93BC160B1EA91AAE04|YyaT], [protein|5E4C3ADF5B5D0215E9E350F16BCA57B208933606|YjcF]
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 1-144) (according to UniProt)
  • Structure

  • [PDB|1Q2Y] (YjcF, 47% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|9EC2800AF5B2B65BE3DEB4ABCCE7E448A24440DF|yybE]-[gene|DBEB1E43E1121D3D8AB6A0CA3BAF4072715F6577|yybD]-[gene|33C3EDF3709AC835C9C50B1B7978BA7C23EC9B9E|yybC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B850 (yybD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1849 NBRP B. subtilis, Japan]
  • BKE40680 (Δ[gene|DBEB1E43E1121D3D8AB6A0CA3BAF4072715F6577|yybD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGACATTCATGCTTGAAT, downstream forward: _UP4_TAGATTGTTCACAAATTTGT
  • BKK40680 (Δ[gene|DBEB1E43E1121D3D8AB6A0CA3BAF4072715F6577|yybD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGACATTCATGCTTGAAT, downstream forward: _UP4_TAGATTGTTCACAAATTTGT