SubtiBank SubtiBank
wprA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

wprA

secreted quality control protease
locus
BSU_10770
pI
9.58
mw
96.29 kDa
protein length
894 aa Sequence Blast
gene length
2685 bp Sequence Blast
function
protein quality control
product
secreted quality control protease
essential
no
synonyms
yisM

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.1|Protein quality control]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,153,789 → 1,156,473

    The protein

    Catalyzed reaction/ biological activity

  • important for [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY]-dependent export of [protein|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|YkuE] and [protein|3985F88334D7B034A66473C5BB39188AB61A65F6|EfeB] [Pubmed|23180473]
  • involved in degradation of [protein|6EE13E61A218A6D52BAC83A1145B0B96961CE289|PrsA], [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|HtrA], and [protein|796216BE9CD6DADFEADC29497253C81BF496A2ED|HtrB] [Pubmed|24362423]
  • Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • [SW|peptidase S8 domain] (aa 422-729) (according to UniProt)
  • Structure

  • [PDB|1DBI] (the peptidase S8 domain from Bacillus sp., aa 458 ... 687, 46% identity) [pubmed|10588904]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • membrane [Pubmed|18763711]
  • cell wall [Pubmed|23180473]
  • Expression and Regulation

    Operons

    genes
    [gene|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|wprA]
    description
    [Pubmed|16306698]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|22900538]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for'[protein|search|wprA]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • 1A1021 ( ''wprA''::''kan''), [Pubmed|20400548], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1021&Search=1A1021 BGSC]
  • BKE10770 (Δ[gene|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|wprA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCCCTCCTGCAAA, downstream forward: _UP4_TAACCAAAAAGCGGTGCTCG
  • BKK10770 (Δ[gene|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|wprA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCCCTCCTGCAAA, downstream forward: _UP4_TAACCAAAAAGCGGTGCTCG
  • References

    Reviews

  • 25212246
  • Original publications

  • 22900538,22923395,23180473,21815947,10075409,11987133,9004506,20525796,18957862,18763711,16306698,9687444,12028417,24362423,24115457,10588904