SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


[SW|RNA polymerase] [SW|sigma factor] SigH, not fully active in laboratory strains due to a mutation (V117A)
25.30 kDa
protein length
218 aa Sequence Blast
gene length
654 bp Sequence Blast
transcription of early stationary phase genes (sporulation, competence)
[SW|RNA polymerase] [SW|sigma factor] SigH

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • Gene

    116,600 → 117,256

    The protein

    Protein family

  • sigma-70 factor family (according to Swiss-Prot)
  • Additional information

  • not fully active in laboratory strains due to a mutation (V117A) [pubmed|27501195]
  • the poor interaction of [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH] with the [SW|RNA polymerase] is responsible for the poor [SW|sporulation] at high salinity, this phenotype can be partially suppressed by specific mutations in [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH] [Pubmed|26712348]
  • Expression and Regulation


    (DBTBS) null

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1898930], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|7592498], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logrithmic growth ([protein|search|AbrB]) [Pubmed|7592498]
  • view in new tab

    Biological materials


  • BKE00980 (Δ[gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGATCCCCCCGGCGC, downstream forward: _UP4_TAATAGGAATTTATGCTATA
  • BKK00980 (Δ[gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGATCCCCCCGGCGC, downstream forward: _UP4_TAATAGGAATTTATGCTATA
  • Labs working on this gene/protein

  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References


  • 20833318
  • The [SW|SigH regulon]

  • 12169614
  • Original Publications

  • 1391042,3123466,2122453,3127379,2502532,6405278,2118512,2509422,1904128,3007003,2500529,9733708,11377871,8600030,7592498,1898930,2509423,20154131,26712348,28507241,27501195,29363854