SubtiBank SubtiBank
sigH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sigH

[SW|RNA polymerase] [SW|sigma factor] SigH, not fully active in laboratory strains due to a mutation (V117A)
locus
BSU_00980
pI
5.15
mw
25.30 kDa
protein length
218 aa Sequence Blast
gene length
657 bp Sequence Blast
function
transcription of early stationary phase genes ([SW|sporulation], competence)
product
[SW|RNA polymerase] [SW|sigma factor] SigH
essential
no
synonyms
spo0H

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • Gene

    Coordinates
    116,600 → 117,256

    The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • Structure

  • [PDB|3MZY] (from Fusobacterium nucleatum, 40% identity)
  • Additional information

  • not fully active in laboratory strains due to a mutation (V117A) [pubmed|27501195]
  • the poor interaction of [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH] with the [SW|RNA polymerase] is responsible for the poor [SW|sporulation] at high salinity, this phenotype can be partially suppressed by specific mutations in [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH] [Pubmed|26712348]
  • Expression and Regulation

    Operons

    genes
    [gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]-[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]-[gene|1007EA15FB7AF81A44400287DB68BCC497158ACF|secE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1898930], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|7592498], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logrithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|7592498]
  • view in new tab

    Biological materials

    Mutant

  • BKE00980 (Δ[gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGATCCCCCCGGCGC, downstream forward: _UP4_TAATAGGAATTTATGCTATA
  • BKK00980 (Δ[gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGATCCCCCCGGCGC, downstream forward: _UP4_TAATAGGAATTTATGCTATA
  • labs

  • [SW|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
  • References

    Reviews

  • 20833318
  • The [SW|SigH regulon]

  • 12169614
  • Original Publications

  • 1391042,3123466,2122453,3127379,2502532,6405278,2118512,2509422,1904128,3007003,2500529,9733708,11377871,8600030,7592498,1898930,2509423,20154131,26712348,28507241,27501195,29363854