sigH [2018-01-25 11:50:41]

[SW|RNA polymerase] [SW|sigma factor] SigH, not fully active in laboratory strains due to a mutation (V117A)

locus: BSU00980

pI: 5.15

mw: 25.30 kDa

protein length: 218 aa

gene length: 654 bp

function: transcription of early stationary phase genes (sporulation, competence)

product: [SW|RNA polymerase] [SW|sigma factor] SigH

essential: no

synonyms: spo0H

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]

Gene

Coordinates: 116,600 → 117,256

The protein

Protein family

• sigma-70 factor family (according to Swiss-Prot)

Additional information

• not fully active in laboratory strains due to a mutation (V117A) [pubmed|27501195]
• the poor interaction of [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH] with the [SW|RNA polymerase] is responsible for the poor [SW|sporulation] at high salinity, this phenotype can be partially suppressed by specific mutations in [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH] [Pubmed|26712348]

Biological materials

Mutant

• BKE00980 (Δ[gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGATCCCCCCGGCGC, downstream forward: _UP4_TAATAGGAATTTATGCTATA
• BKK00980 (Δ[gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGATCCCCCCGGCGC, downstream forward: _UP4_TAATAGGAATTTATGCTATA

Labs working on this gene/protein

• [SW|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]

References

Reviews

• 20833318

The [SW|SigH regulon]

• 12169614

Original Publications

• 1391042,3123466,2122453,3127379,2502532,6405278,2118512,2509422,1904128,3007003,2500529,9733708,11377871,8600030,7592498,1898930,2509423,20154131,26712348,28507241,27501195