SubtiBank SubtiBank
treR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

treR

transcription repressor of the [gene|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]-[gene|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA]-[gene|search|treR ]operon ([SW|GntR family])
locus
BSU_07820
pI
6.82
mw
27.69 kDa
protein length
238 aa Sequence Blast
gene length
717 bp Sequence Blast
function
regulation of trehalose utilization
product
transcription repressor ([SW|GntR family])
essential
no
synonyms
yfxA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.20|Utilization of trehalose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    853,556 → 854,272

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • [SW|Domains]

  • [SW|HTH gntR-type domain] (aa 1-71) (according to UniProt)
  • Structure

  • [PDB|2OGG] (effector binding domain) [Pubmed|17705272]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000087 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]-[gene|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA]-[gene|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|treR]
    description
    [Pubmed|8755887]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8755887], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR]: repression, [Pubmed|8755887], in [regulon|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18977770], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|21636651], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|21636651]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C261 (treR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2259 NBRP B. subtilis, Japan]
  • BKE07820 (Δ[gene|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|treR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGGACCACCCAGCTT, downstream forward: _UP4_TGAGAGAGGCGCCTGCCTGC
  • BKK07820 (Δ[gene|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|treR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGGACCACCCAGCTT, downstream forward: _UP4_TGAGAGAGGCGCCTGCCTGC
  • References

  • 8755887,9829827,8917076,17705272,18977770