SubtiBank SubtiBank
yhfO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhfO

predicted acyltransferase
locus
BSU_10310
pI
7.90
mw
16.61 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,106,003 → 1,106,452

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 1-149) (according to UniProt)
  • Structure

  • [PDB|2EUI] (from ''Pseudomonas aeruginosa ''(PAO1), 40% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|DCA3A7605CA19FAF61BDB75421BD41F11CB638E5|yhfO]-[gene|FE034FDCEAD4F4E91FD0147E16685632069E3316|yhfP]-[gene|1469148C83B1704E721652203EA31F0E2C33FDC6|yhfQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A796 (yhfO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/796 NBRP B. subtilis, Japan]
  • BKE10310 (Δ[gene|DCA3A7605CA19FAF61BDB75421BD41F11CB638E5|yhfO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTTCTTCCTCCCT, downstream forward: _UP4_TGAAAATGGCGGCTTGATGA
  • BKK10310 (Δ[gene|DCA3A7605CA19FAF61BDB75421BD41F11CB638E5|yhfO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTTCTTCCTCCCT, downstream forward: _UP4_TGAAAATGGCGGCTTGATGA