SubtiBank SubtiBank
yxlG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxlG

similar to [SW|ABC transporter] (membrane protein)
locus
BSU_38650
pI
9.26
mw
27.99 kDa
protein length
259 aa Sequence Blast
gene length
777 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (membrane protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.3|Export of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,967,944 → 3,968,720

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|801E92306971E26AD4AB155172B7F4EFDE2F9170|sigY]-[gene|C07156CBA0AA3BAB24D17D15708FC68E74A854A7|yxlC]-[gene|CAADFAFD4C39362D0D0F242C926AE101C683EB5D|yxlD]-[gene|B40D01DDD9EF8B64E46CA7DBF4BAC3DBF8A73986|yxlE]-[gene|D246F61BEAE0D3D6707B4C43A634C02876CC5395|yxlF]-[gene|DCC03844AC58A198B851B564D0A6459C39EBDA2F|yxlG]
    description
    [Pubmed|14769884]

    sigma factors

  • [protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY]: sigma factor, [Pubmed|12897008], in [regulon|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B753 (yxlG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1752 NBRP B. subtilis, Japan]
  • BKE38650 (Δ[gene|DCC03844AC58A198B851B564D0A6459C39EBDA2F|yxlG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATGCGTGCACCACCTT, downstream forward: _UP4_TATTAATTGATCATGTTACG
  • BKK38650 (Δ[gene|DCC03844AC58A198B851B564D0A6459C39EBDA2F|yxlG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATGCGTGCACCACCTT, downstream forward: _UP4_TATTAATTGATCATGTTACG
  • References

  • 14769884,10092453,12897008