SubtiBank SubtiBank
immR
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

immR

transcriptional repressor (Xre family), controls expression of genes of the mobile genetic element ICEBs1, induction by the SOS response or the RapI-PhrI sensory system
locus
BSU04820
pI
4.99
mw
14.51 kDa
protein length
127 aa Sequence Blast
gene length
381 bp Sequence Blast
function
control of transfer of the mobile genetic element ICEBs1
product
transcriptional repressor (Xre family)
essential
no
synonyms
ydcN

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • Gene

    Coordinates
    531,130 → 531,513

    The protein

    Protein family

  • [SW|Xre family]
  • Effectors of protein activity

  • binding of [protein|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|RapI] to ImmR results in loss of DNA-binding activity of ImmR and subsequently in induction of ImmR-repressed genes [Pubmed|17511812]
  • Expression and Regulation

    Operons

    genes
    [gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]-[gene|1599BBAC05EB62A847F73572CD777BC472301DE8|immA]-[gene|47AE982C5E71F31B5AF04C4F50593C2629F8EDAF|int]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE04820 (Δ[gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATCATCCATTTCA, downstream forward: _UP4_ATTGACGAATTAAAGAAGAA
  • BKK04820 (Δ[gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATCATCCATTTCA, downstream forward: _UP4_ATTGACGAATTAAAGAAGAA
  • References

    Reviews

  • 24995588
  • Original publications

  • 17511812,18761623,21036995