SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor ([SW|Xre family]), controls expression of genes of the mobile genetic element ICEBs1, induction by the SOS response or the [protein|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|RapI]-[protein|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|PhrI] sensory system
14.51 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
control of transfer of the mobile genetic element ICEBs1
transcriptional repressor ([SW|Xre family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • Gene

    531,130 → 531,513

    The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 7-61) (according to UniProt)
  • Effectors of protein activity

  • binding of [protein|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|RapI] to ImmR results in loss of DNA-binding activity of ImmR and subsequently in induction of ImmR-repressed genes [Pubmed|17511812]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • BKE04820 (Δ[gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATCATCCATTTCA, downstream forward: _UP4_ATTGACGAATTAAAGAAGAA
  • BKK04820 (Δ[gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATCATCCATTTCA, downstream forward: _UP4_ATTGACGAATTAAAGAAGAA
  • References


  • 24995588
  • Original publications

  • 17511812,18761623,21036995