SubtiBank SubtiBank
ymaG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ymaG

spore coat protein
locus
BSU_17310
pI
9.68
mw
13.64 kDa
protein length
gene length
276 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • Gene

    Coordinates
    1,865,512 → 1,865,787

    The protein

    [SW|Localization]

  • inner spore coat [Pubmed|22171814,19933362]
  • localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|DD441801394C75BA597D8029BED4CAD54ACCAD1C|ymaG]
    description
    [Pubmed|12480901]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836,15699190,12480901]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B071 (ymaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1070 NBRP B. subtilis, Japan]
  • BKE17310 (Δ[gene|DD441801394C75BA597D8029BED4CAD54ACCAD1C|ymaG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCTTTCCTCCTGT, downstream forward: _UP4_TAAACGCAAAAGACCCCTTA
  • BKK17310 (Δ[gene|DD441801394C75BA597D8029BED4CAD54ACCAD1C|ymaG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCTTTCCTCCTGT, downstream forward: _UP4_TAAACGCAAAAGACCCCTTA
  • References

  • 15699190,12480901,19933362,22171814,15383836