SubtiBank SubtiBank


spore killing factor
5.80 kDa
protein length
gene length
168 bp Sequence Blast
killing of sister cells
spore killing factor

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    213,941 → 214,108

    The protein


  • the mature SKF is cyclic 26-amino acid peptide that is posttranslationally modified with one disulfide and one cysteine thioether bridged to the alpha-position of a methionine [Pubmed|20805502], the thioether bond is generated by [protein|F981C605C652D1A4429579A5F24608CE7F570834|SkfB] [Pubmed|23282011]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16452424], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16816204], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [,15687200 PubMed]
  • additional information

  • Northern blotting during during phosphate limitation showed an intense 0.25 kb '[protein|search|skfA]'-specific transcript, and a weaker 6.5 kb '[protein|search|skfA]-[protein|search|skfB]-[protein|search|skfC]-[protein|search|skfE]-[protein|search|skfF]-[protein|search|skfG]-[protein|search|skfH]' transcript.
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • MGNA-B971 (ybcO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE01910 (Δ[gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTAAACCTCCTCTCA, downstream forward: _UP4_TAACATTTGAGAATAGGGAG
  • BKK01910 (Δ[gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTAAACCTCCTCTCA, downstream forward: _UP4_TAACATTTGAGAATAGGGAG
  • GFP fusion

  • GP1645 ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''::''spc'' P''skf-gfp'' (''cat'') in the NCIB3610 background, available in [SW| Jörg Stülke]'s lab
  • References


  • 20955377