SubtiBank SubtiBank
ydaE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydaE

lyxose isomerase, general stress protein, survival of ethanol stress and low temperatures
locus
BSU_04200
pI
4.88
mw
19.11 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast
function
survival of ethanol stress and low temperatures
product
lyxose isomerase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.28|Utilization of other pentoses and hexoses]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    472,585 → 473,088

    The protein

    Catalyzed reaction/ biological activity

  • D-lyxose --> D-xylulose (according to UniProt)
  • Protein family

  • D-lyxose ketol-isomerase family (single member, according to UniProt)
  • Structure

  • [PDB|2Y0O] [Pubmed|21520290]
  • Expression and Regulation

    Operons

    genes
    [gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|15805528,10220166], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    genes
    [gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]-[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,10220166], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C087 (ydaE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2085 NBRP B. subtilis, Japan]
  • BKE04200 (Δ[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGCCCATATGTCTCACTC, downstream forward: _UP4_TAAGGATGGGCTTAACAGCC
  • BKK04200 (Δ[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGCCCATATGTCTCACTC, downstream forward: _UP4_TAAGGATGGGCTTAACAGCC
  • References

  • 10220166,15805528,23033921,21520290