SubtiBank SubtiBank
ypmP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypmP

unknown
locus
BSU_21760
pI
9.94
mw
10.05 kDa
protein length
gene length
252 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,292,432 → 2,292,683

    Expression and Regulation

    Operons

    genes
    [gene|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|ilvA]-[gene|DE113BB32600349C472D3417B760D640B65B01AB|ypmP]
    description
    [Pubmed|15060025]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B270 (ypmP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1269 NBRP B. subtilis, Japan]
  • GP564, aphA3, available in the [SW|Stülke] lab
  • BKE21760 (Δ[gene|DE113BB32600349C472D3417B760D640B65B01AB|ypmP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCTATCAATCCTCTTTT, downstream forward: _UP4_TAACATGCCGTTTTTTACCT
  • BKK21760 (Δ[gene|DE113BB32600349C472D3417B760D640B65B01AB|ypmP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCTATCAATCCTCTTTT, downstream forward: _UP4_TAACATGCCGTTTTTTACCT
  • References

  • 12618455,15060025,15060025