SubtiBank SubtiBank
ytbE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytbE

putative aldo/keto reductase, may be involved in detoxification
locus
BSU_29050
pI
4.79
mw
31.62 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast
function
unknown
product
putative aldo/keto reductase
essential
no
ec
1.-.-.-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,970,038 → 2,970,880

    Phenotypes of a mutant

  • essential [Pubmed|17114254], non-essential according to [Pubmed|28189581]
  • The protein

    Protein family

  • [SW|Nudix hydrolase]
  • [SW|Aldo/keto reductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|YvgN]
  • Structure

  • [PDB|3B3D] [Pubmed|19585557]
  • Expression and Regulation

    Operons

    genes
    [gene|BADE5937ECB41C96C82E6A3BDA8FDC9BFC21F219|ytbD]-[gene|DE12190315DADF13DA1BA272924729BBF909B1D9|ytbE]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A119 (ytbE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/119 NBRP B. subtilis, Japan]
  • BKE29050 (Δ[gene|DE12190315DADF13DA1BA272924729BBF909B1D9|ytbE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATTTCCTCCTTTA, downstream forward: _UP4_TAATGGCCAAAAAACACCGT
  • BKK29050 (Δ[gene|DE12190315DADF13DA1BA272924729BBF909B1D9|ytbE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATTTCCTCCTTTA, downstream forward: _UP4_TAATGGCCAAAAAACACCGT
  • References

  • 17114254,19585557,28189581