SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


72.62 kDa
protein length
660 aa Sequence Blast
gene length
1980 bp Sequence Blast
starch degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of starch/ maltodextrin]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    327,618 → 329,597

    The protein

    Catalyzed reaction/ biological activity

  • Endohydrolysis of (1->4)-alpha-D-glucosidic linkages in polysaccharides containing three or more (1->4)-alpha-linked D-glucose units (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Structure

  • [PDB|1BAG] (complex with maltopentaose)
  • [SW|Localization]

  • secreted (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3123701], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7665492], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|7665492]
  • view in new tab

    Biological materials


  • GP550 (cat), available in [SW|Stülke] lab
  • BKE03040 (Δ[gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTGACACTCCTTATT, downstream forward: _UP4_TGAGGGCAAGGCTAGACGGG
  • BKK03040 (Δ[gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTGACACTCCTTATT, downstream forward: _UP4_TGAGGGCAAGGCTAGACGGG
  • References


  • 28724440
  • Original publications

  • 1904524,3123701,18957862,21948839,23262127,22900538,20817675,21512239,25431404