SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to transcriptional regulator (MarR family)
18.07 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    916,124 → 916,606

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C357 (yfiV::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08410 (Δ[gene|DE880F5577B6D86B2E62437E392D48AFA9BCE48B|yfiV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATCACTTCCTCATC, downstream forward: _UP4_TAAATCAGTAAGTCTGTCAT
  • BKK08410 (Δ[gene|DE880F5577B6D86B2E62437E392D48AFA9BCE48B|yfiV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATCACTTCCTCATC, downstream forward: _UP4_TAAATCAGTAAGTCTGTCAT