SubtiBank SubtiBank
hisH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hisH

imidazole glycerol phosphate synthase (glutaminase subunit)
locus
BSU_34890
pI
5.72
mw
23.16 kDa
protein length
212 aa Sequence Blast
gene length
639 bp Sequence Blast
function
biosynthesis of histidine
product
imidazole glycerol phosphate synthase (glutaminase subunit)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.14|Biosynthesis/ acquisition of histidine]
  • Gene

    Coordinates
    3,585,051 → 3,585,689

    The protein

    Catalyzed reaction/ biological activity

  • 5-[(5-phospho-1-deoxy-D-ribulos-1-ylimino)methylamino]-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamide + L-glutamine --> 5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamide + D-erythro-1-(imidazol-4-yl)glycerol 3-phosphate + H+ + L-glutamate (according to UniProt)
  • H2O + L-glutamine --> L-glutamate + NH4+ (according to UniProt)
  • [SW|Domains]

  • [SW|Glutamine amidotransferase type-1 domain] (aa 1-211) (according to UniProt)
  • Structure

  • [PDB|1KA9] (the [protein|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|HisF]-[protein|DEB3122A3EA36545759FAA6F86F71F971CA5F011|HisH] complex from ''Thermus thermophilus'', 39% identity) [Pubmed|12417026]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|E8FD92F48BE16F87D7481262F4E49003A78DE78F|hisZ]-[gene|183C8B4F28E601D670B3D997D333AF2B5C4A4759|hisG]-[gene|03274B80B2DFE0A2939981B0E0CB8C34A9B0B102|hisD]-[gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]-[gene|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH]-[gene|148F0C7983250F50676D234DB713E532AA55DDBF|hisA]-[gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]-[gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE34890 (Δ[gene|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCGTAATCTATCACGCCGA, downstream forward: _UP4_GCAGCAGAACAGAAGGTGAA
  • BKK34890 (Δ[gene|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCGTAATCTATCACGCCGA, downstream forward: _UP4_GCAGCAGAACAGAAGGTGAA
  • References

    Reviews

  • 12859215
  • Original publications

  • 3106153,12107147,12417026,27766092