SubtiBank SubtiBank


radical S-adenosylmethionine enzyme, antilisterial bacteriocin (subtilosin) production
51.35 kDa
protein length
448 aa Sequence Blast
gene length
1347 bp Sequence Blast
antilisterial bacteriocin (subtilosin) production
radical S-adenosylmethionine enzyme

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    3,836,323 → 3,837,669

    The protein

    Catalyzed reaction/ biological activity

  • catalyzes thioether bond formation in subtilosin A [Pubmed|22366720]
  • [SW|Cofactors]

  • contains two Fe-S clusters [Pubmed|22366720]
  • Structure

  • [PDB|6EFN] ([protein|F981C605C652D1A4429579A5F24608CE7F570834|SkfB],corresponds to aa 109 ... 382, 32% identity) [pubmed|30217813]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10572140], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10809710], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10572140,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|10809710]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-B263 (ywiA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37370 (Δ[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATACCATCCCCTATAC, downstream forward: _UP4_CAGCTTATTTAGGAGGGAAA
  • BKK37370 (Δ[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATACCATCCCCTATAC, downstream forward: _UP4_CAGCTTATTTAGGAGGGAAA
  • References

  • 10809709,10572140,15743949,10809710,10572140,17720793,17190806,30217813