SubtiBank SubtiBank
fadF

fadF

similar to iron-sulphur-binding reductase
locus
BSU_37180
pI
6.53
mw
79.00 kDa
protein length
705 aa Sequence Blast
gene length
2118 bp Sequence Blast
function
fatty acid degradation
product
unknown
essential
no
synonyms
ywjF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,814,382 → 3,816,499

    The protein

    [SW|Domains]

  • 2 [SW|4Fe-4S ferredoxin-type domain]s (aa 268-298, aa 360-391) (according to UniProt)
  • [SW|Cofactors]

  • 2 4Fe-4S clusters [pubmed|29292548]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|DEE0DA15EE9EA27BA8C332204E40D336324A111C|fadF]-[gene|7D89BBB52403BF99416250688EFA90C2BE8EB591|acdA]-[gene|632C661255DD9C2865CB2F9D68A805997A833BCB|rpoE]
    description
    [Pubmed|17189250]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17189250], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • regulation

  • repressed in the absence of long-chain fatty acids ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A555 (ywjF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/555 NBRP B. subtilis, Japan]
  • BKE37180 (''[gene|DEE0DA15EE9EA27BA8C332204E40D336324A111C|fadF]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE37180 (Δ[gene|DEE0DA15EE9EA27BA8C332204E40D336324A111C|fadF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAATTCCCCCTTTTT, downstream forward: _UP4_GATCTGAAAATGGGGGAGAA
  • BKK37180 (Δ[gene|DEE0DA15EE9EA27BA8C332204E40D336324A111C|fadF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAATTCCCCCTTTTT, downstream forward: _UP4_GATCTGAAAATGGGGGAGAA
  • References

  • 12850135,17189250,23033921