SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


phosphoribosylformylglycinamidine synthase
24.64 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast
purine biosynthesis
phosphoribosylformylglycinamidine synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    702,570 → 703,253

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + L-glutamine + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide --> 2-(formamido)-N1-(5-phospho-D-ribosyl)acetamidine + ADP + H+ + L-glutamate + phosphate(according to UniProt)
  • H2O + L-glutamine --> L-glutamate + NH4+ (according to UniProt)
  • [SW|Domains]

  • [SW|Glutamine amidotransferase type-1 domain] (aa 3-225) (according to UniProt)
  • Structure

  • [PDB|3D54] (from ''Thermotoga maritima'', 51% identity) [Pubmed|18597481]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • BKE06470 (Δ[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGGTAACACAATCACCGCAA, downstream forward: _UP4_ATCGTGAAAAATTGGAGGGA
  • BKK06470 (Δ[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGGTAACACAATCACCGCAA, downstream forward: _UP4_ATCGTGAAAAATTGGAGGGA
  • References

  • 15301530,3036807,12923093,7638212,12850135,18597481