SubtiBank SubtiBank
purQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

purQ

phosphoribosylformylglycinamidine synthase
locus
BSU_06470
pI
4.63
mw
24.64 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylformylglycinamidine synthase
essential
no
ec
6.3.5.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    702,570 → 703,253

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + L-glutamine + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide --> 2-(formamido)-N1-(5-phospho-D-ribosyl)acetamidine + ADP + H+ + L-glutamate + phosphate(according to UniProt)
  • H2O + L-glutamine --> L-glutamate + NH4+ (according to UniProt)
  • [SW|Domains]

  • [SW|Glutamine amidotransferase type-1 domain] (aa 3-225) (according to UniProt)
  • Structure

  • [PDB|3D54] (from ''Thermotoga maritima'', 51% identity) [Pubmed|18597481]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE06470 (Δ[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGGTAACACAATCACCGCAA, downstream forward: _UP4_ATCGTGAAAAATTGGAGGGA
  • BKK06470 (Δ[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGGTAACACAATCACCGCAA, downstream forward: _UP4_ATCGTGAAAAATTGGAGGGA
  • References

  • 15301530,3036807,12923093,7638212,12850135,18597481