SubtiBank SubtiBank
ydhD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydhD

spore coat peptidoglycan hydrolase
locus
BSU_05710
pI
9.07
mw
48.80 kDa
protein length
420 aa Sequence Blast
gene length
1263 bp Sequence Blast
function
unknown
product
spore coat glycosylase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.6|Cell wall/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    616,672 → 617,934

    The protein

    Protein family

  • [SW|Glycosyl hydrolase 18 family] (according to UniProt)
  • Chitinase class II subfamily (with [protein|77BEC74867422AA225A1F12AD63464656DBDCBE8|YaaH], according to UniProt)
  • Paralogous protein(s)

  • [protein|77BEC74867422AA225A1F12AD63464656DBDCBE8|YaaH]
  • [SW|Domains]

  • contains two N-acetylglucosamine-polymer-binding [SW|LysM domain]s at the N-terminus [Pubmed|18430080]
  • [SW|glycoside hydrolase family 18 domain ] (aa 120 to 400)
  • 2 [SW|LysM domain]s (aa 2-45, aa 48-92) (according to UniProt)
  • Structure

  • [PDB|3CZ8]
  • [SW|Localization]

  • spore wall (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|DFA0BFED9FC2C47ABAA2284514CE2F81BD9EDFEF|ydhD]
    description
    [Pubmed|11011148]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|11011148,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE])
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C179 (ydhD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2177 NBRP B. subtilis, Japan]
  • BKE05710 (Δ[gene|DFA0BFED9FC2C47ABAA2284514CE2F81BD9EDFEF|ydhD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTAACCCCCATTATT, downstream forward: _UP4_TAAAAAAAGACACCAGAGCT
  • BKK05710 (Δ[gene|DFA0BFED9FC2C47ABAA2284514CE2F81BD9EDFEF|ydhD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTAACCCCCATTATT, downstream forward: _UP4_TAAAAAAAGACACCAGAGCT
  • References

    Reviews

  • 18430080
  • Original publications

  • 11011148,15699190