SubtiBank SubtiBank
yvdA
The papers of the month are back! Check them out! Link here

yvdA

similar to carbonic anhydrase
locus
BSU34670
pI
6.88
mw
21.57 kDa
protein length
197 aa Sequence Blast
gene length
591 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,561,590 → 3,562,183

    The protein

    Paralogous protein(s)

  • [protein|F942C0F4618FACEF35ACA629355BAC288556E7B6|YtiB]
  • [protein|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|YbcF]: (29.4%)
  • Structure

  • [PDB|1G5C] (from Methanobacterium thermoautotrophicum 40% identity) [pubmed|11096105]
  • Expression and Regulation

    Operons

    genes
    [gene|E00889289B07BE78CC0C8E0962A55C3B14871E00|yvdA]-[gene|7028580E25DD6C1D49A14F29DDCC02012F94FED7|yvdB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B632 (yvdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1631 NBRP B. subtilis, Japan]
  • BKE34670 (Δ[gene|E00889289B07BE78CC0C8E0962A55C3B14871E00|yvdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCCATCCATATGATT, downstream forward: _UP4_TCATAAGGGAGGTTATAACA
  • BKK34670 (Δ[gene|E00889289B07BE78CC0C8E0962A55C3B14871E00|yvdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCCATCCATATGATT, downstream forward: _UP4_TCATAAGGGAGGTTATAACA
  • References

  • 22383849,11096105