SubtiBank SubtiBank
yvdA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvdA

similar to carbonic anhydrase
locus
BSU_34670
pI
6.88
mw
21.57 kDa
protein length
197 aa Sequence Blast
gene length
594 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,561,590 → 3,562,183

    The protein

    Catalyzed reaction/ biological activity

  • H+ + hydrogencarbonate --> CO2 + H2O (according to UniProt)
  • Protein family

  • beta-class carbonic anhydrase family (with [protein|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|YbcF] and [protein|F942C0F4618FACEF35ACA629355BAC288556E7B6|YtiB], according to UniProt)
  • Paralogous protein(s)

  • [protein|F942C0F4618FACEF35ACA629355BAC288556E7B6|YtiB]
  • [protein|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|YbcF]: (29.4%)
  • Structure

  • [PDB|1G5C] (from Methanobacterium thermoautotrophicum 40% identity) [pubmed|11096105]
  • Expression and Regulation

    Operons

    genes
    [gene|E00889289B07BE78CC0C8E0962A55C3B14871E00|yvdA]-[gene|7028580E25DD6C1D49A14F29DDCC02012F94FED7|yvdB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B632 (yvdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1631 NBRP B. subtilis, Japan]
  • BKE34670 (Δ[gene|E00889289B07BE78CC0C8E0962A55C3B14871E00|yvdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCCATCCATATGATT, downstream forward: _UP4_TCATAAGGGAGGTTATAACA
  • BKK34670 (Δ[gene|E00889289B07BE78CC0C8E0962A55C3B14871E00|yvdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCCATCCATATGATT, downstream forward: _UP4_TCATAAGGGAGGTTATAACA
  • References

  • 22383849,11096105