SubtiBank SubtiBank
mtrB
The papers of the month are back! Check them out! Link here

mtrB

tryptophan operon RNA-binding attenuation protein (TRAP), controls the RNA switch in front of genes involved in biosynthesis and acquisition of tryptophan
locus
BSU22770
pI
7.33
mw
8.19 kDa
protein length
gene length
225 bp Sequence Blast
function
regulation of tryptophan biosynthesis(and translation) attenuation in the trp operon;repression of the folate operon
product
tryptophan operon RNA-binding attenuation protein (TRAP)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • Gene

    Coordinates
    2,384,534 → 2,384,761

    The protein

    Protein family

  • prpD family (according to Swiss-Prot)
  • Effectors of protein activity

  • binding of tryptophan results RNA binding and thus in transcription termination
  • Structure

  • [PDB|3AQD], [PDB|1WAP] (complex with L-tryptophan), [PDB|2ZP9] (complex with [protein|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|RtpA])
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000015 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|folE]-[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]
    description
    [Pubmed|2123343]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2123343], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive [Pubmed|19767425]
  • view in new tab

    Biological materials

    Mutant

  • BKE22770 (Δ[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATAGCACCCTCTATC, downstream forward: _UP4_TAAGCTGGCTGTCCCCGCTG
  • BKK22770 (Δ[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATAGCACCCTCTATC, downstream forward: _UP4_TAAGCTGGCTGTCCCCGCTG
  • References

    Reviews

  • 19385727,16285852,15063849
  • Original Publications

  • 22970197,19033375,17881743,10660627,10714985,12963367,14702295,16879415,17114058,17114263,11805104,7525975,10735881,15262953,14976255,8647825,18334255,10499579,7715723,8932308,11214184,15743934,7515880,9242649,7759487,15050822,14687568,9245598,9765233,11914485,15099736,7678334,8643393,15588817,16738132,1551827,17555767,7544009,11786553,11566976,2123343,11557884,12133840,16784236,10369778,7715723,10499579,11566976,7515880,21097886,21984911,24505391,24572018,24682818,25579595,27812824,28069823