SubtiBank SubtiBank
ybfQ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybfQ

unknown
locus
BSU_02330
pI
4.91
mw
37.11 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    252,514 → 253,482

    The protein

    Protein family

  • UPF0176 family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|Rhodanese domain] (aa 125-219) (according to UniProt)
  • Structure

  • [PDB|4F67] (from Legionella pneumophila, corresponds to aa 10 ... 234, 41% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]-[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]
    description
    [Pubmed|12207695]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B936 (ybfQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1935 NBRP B. subtilis, Japan]
  • BKE02330 (Δ[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTAAACACCCTGTT, downstream forward: _UP4_TAAAAAAAGAACACCTCGTA
  • BKK02330 (Δ[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTAAACACCCTGTT, downstream forward: _UP4_TAAAAAAAGAACACCTCGTA
  • References

  • 12207695