SubtiBank SubtiBank
bslA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bslA

bacterial hydrophobin, forms water-repellent surface layer of the biofilm, required for sliding, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] autophosphorylation, and subsequently of entry into [SW|sporulation]
locus
BSU_31080
pI
9.99
mw
19.11 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
[SW|biofilm formation], control of entry into [SW|sporulation] via the [SW|phosphorelay]
product
biofilm surface layer, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] autophosphorylation
essential
no
synonyms
yuaB,sivB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.2|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.3|Repellent surface layer]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.2|Proteins controlling the activity of the kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,187,503 → 3,188,048

    Phenotypes of a mutant

  • reduced colony complexity [Pubmed|21742882]
  • loss of surface repellency of the biofilm [Pubmed|22571672]
  • diminished [SW|sliding] of ''B. subtilis'' natto [Pubmed|26152584]
  • The protein

    Catalyzed reaction/ biological activity

  • inhibits [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] autophophorylation [Pubmed|23335417]
  • contributes to the surface stiffness and increases the surface roughness of NCIB 3610 bioflms [Pubmed|26873313]
  • Protein family

  • BslA/BslB family (with [protein|E5E2994D96FCECEE75E15136A08308C7B6C1C183|SivA], according to UniProt)
  • Paralogous protein(s)

  • [protein|E5E2994D96FCECEE75E15136A08308C7B6C1C183|SivA]
  • Structure

  • [PDB|4BHU] [Pubmed|23904481]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • biofilm matrix in an extracellular polysaccharide-dependent manner [Pubmed|22571672]
  • forms a layer on the biofilm surface [Pubmed|22571672]
  • Expression and Regulation

    Operons

    genes
    [gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18978066], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: activation, [Pubmed|24196425], in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|18978066], this might be indirect [Pubmed|21742882], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A218 (yuaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/218 NBRP B. subtilis, Japan]
  • ''B. subtilis'' W939 ''bslA''::Cm (ATCC6051 based) [Pubmed|17850253]
  • ''B. subtilis'' NRS2097 ''bslA''::Cm (NCIB3610 based) [Pubmed|18978066]
  • ''B. subtilis'' ''bslA''::Cm (168 based) [Pubmed|21097620]
  • BKE31080 (Δ[gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAAATTCCCCCTAA, downstream forward: _UP4_TAATGTAAAAGACCGGTTAA
  • BKK31080 (Δ[gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAAATTCCCCCTAA, downstream forward: _UP4_TAATGTAAAAGACCGGTTAA
  • Expression vectors

  • Physpank-bslA based on vector pDR111: pDRyuaB2 [Pubmed|21097620]
  • lacZ fusion

  • pNW500 P''bslA-lacZ'' fusion in pDG1663 [Pubmed|18978066]
  • GFP fusion

  • P''bslA-gfp'' fusion in pSG1151 vector: pSGyuaB [Pubmed|21097620]
  • References

    Reviews

  • 22607588,23979433,24988880,25907113,27458867
  • Original publications

  • 27298433,22571672,18978066,18957862,17850253,21097620,21742882,22383849,23335417,23904481,22571672,25870300,26152584,26378478,26873313,28698374,28701036,28751732,29623706