SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


bacterial hydrophobin, forms water-repellent surface layer of the biofilm, required for sliding, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] autophosphorylation, and subsequently of entry into [SW|sporulation]
19.11 kDa
protein length
181 aa Sequence Blast
gene length
543 bp Sequence Blast
[SW|biofilm formation], control of entry into [SW|sporulation] via the [SW|phosphorelay]
biofilm surface layer, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] autophosphorylation

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Repellent surface layer]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Proteins controlling the activity of the kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,187,503 → 3,188,048

    Phenotypes of a mutant

  • reduced colony complexity [Pubmed|21742882]
  • loss of surface repellency of the biofilm [Pubmed|22571672]
  • diminished [SW|sliding] of ''B. subtilis'' natto [Pubmed|26152584]
  • The protein

    Catalyzed reaction/ biological activity

  • inhibits [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] autophophorylation [Pubmed|23335417]
  • contributes to the surface stiffness and increases the surface roughness of NCIB 3610 bioflms [Pubmed|26873313]
  • Paralogous protein(s)

  • [protein|E5E2994D96FCECEE75E15136A08308C7B6C1C183|SivA]
  • Structure

  • [PDB|4BHU] [Pubmed|23904481]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • biofilm matrix in an extracellular polysaccharide-dependent manner [Pubmed|22571672]
  • forms a layer on the biofilm surface [Pubmed|22571672]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18978066], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: activation, [Pubmed|24196425], in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|18978066], this might be indirect [Pubmed|21742882], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab

    Biological materials


  • MGNA-A218 (yuaB::erm), available at the [ NBRP B. subtilis, Japan]
  • ''B. subtilis'' W939 ''bslA''::Cm (ATCC6051 based) [Pubmed|17850253]
  • ''B. subtilis'' NRS2097 ''bslA''::Cm (NCIB3610 based) [Pubmed|18978066]
  • ''B. subtilis'' ''bslA''::Cm (168 based) [Pubmed|21097620]
  • BKE31080 (Δ[gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAAATTCCCCCTAA, downstream forward: _UP4_TAATGTAAAAGACCGGTTAA
  • BKK31080 (Δ[gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAAATTCCCCCTAA, downstream forward: _UP4_TAATGTAAAAGACCGGTTAA
  • Expression vector

  • Physpank-bslA based on vector pDR111: pDRyuaB2 [Pubmed|21097620]
  • lacZ fusion

  • pNW500 P''bslA-lacZ'' fusion in pDG1663 [Pubmed|18978066]
  • GFP fusion

  • P''bslA-gfp'' fusion in pSG1151 vector: pSGyuaB [Pubmed|21097620]
  • References


  • 22607588,23979433,24988880,25907113,27458867
  • Original publications

  • 27298433,22571672,18978066,18957862,17850253,21097620,21742882,22383849,23335417,23904481,22571672,25870300,26152584,26378478,26873313,28698374,28701036,28751732