SubtiBank SubtiBank
licR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

licR

transcriptional activator of the [gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH] operon
locus
BSU_38600
pI
6.11
mw
73.14 kDa
protein length
641 aa Sequence Blast
gene length
1926 bp Sequence Blast
function
regulation of lichenan utilization
product
transcriptional activator, [SW|PRD]-type
essential
no
ec
2.7.1.69
synonyms
celR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,962,003 → 3,963,928

    The protein

    Protein family

  • [SW|PRD-containing transcription factors]
  • Modification

  • phosphorylation (His219, His278, His333, His392, Cys413, His559) (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]
    description
    [Pubmed|8990303]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8990303], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE38600 (Δ[gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGAAAAACCTCCTAAC, downstream forward: _UP4_TGACAGCCTGTATATACCTT
  • BKK38600 (Δ[gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGAAAAACCTCCTAAC, downstream forward: _UP4_TGACAGCCTGTATATACCTT
  • References

  • 8990303,10438772