SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional activator of the licB-licC-licA-licH operon
73.14 kDa
protein length
641 aa Sequence Blast
gene length
1923 bp Sequence Blast
regulation of lichenan utilization
transcriptional activator, PRD-type

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|PRD-type regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    3,962,003 → 3,963,928

    The protein

    Catalyzed reaction/ biological activity

  • Protein EIIA N(pi)-phospho-L-histidine + protein EIIB = protein EIIA + protein EIIB N(pi)-phospho-L-histidine/cysteine (according to Swiss-Prot)
  • Protein family

  • transcriptional antiterminator bglG family (according to Swiss-Prot), '''Attention:''' this is wrong: LicR is a transcription activator, the similarity to the BglG family is limited to the [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI]-regulation domains
  • Modification

  • phosphorylation (His219, His278, His333, His392, Cys413, His559) (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8990303], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE38600 (Δ[gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGAAAAACCTCCTAAC, downstream forward: _UP4_TGACAGCCTGTATATACCTT
  • BKK38600 (Δ[gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGAAAAACCTCCTAAC, downstream forward: _UP4_TGACAGCCTGTATATACCTT
  • References

  • 8990303,10438772