SubtiBank SubtiBank
ylmA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ylmA

similar to [SW|ABC transporter] (ATP-binding protein)
locus
BSU_15340
pI
5.13
mw
29.58 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

Gene

Coordinates
1,606,560 → 1,607,354

The protein

Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 3-243) (according to UniProt)
  • Structure

  • [PDB|2IHY] (from Staphylococcus aureus, 42% identity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|E12006960D9C75EBD4CD79A84B80BE51A9CC79D2|ylmA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B123 (ylmA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1122 NBRP B. subtilis, Japan]
  • BKE15340 (Δ[gene|E12006960D9C75EBD4CD79A84B80BE51A9CC79D2|ylmA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTCCTCCTCTTTA, downstream forward: _UP4_ACGAATGCCTGACAAATATA
  • BKK15340 (Δ[gene|E12006960D9C75EBD4CD79A84B80BE51A9CC79D2|ylmA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTCCTCCTCTTTA, downstream forward: _UP4_ACGAATGCCTGACAAATATA
  • References

  • 10092453,15378759,18083814