SubtiBank SubtiBank
citB
The papers of the month are back! Check them out! Link here

citB

aconitase, trigger enzyme
locus
BSU18000
pI
4.90
mw
99.14 kDa
protein length
909 aa Sequence Blast
gene length
2727 bp Sequence Blast
function
TCA cycle
product
aconitase, trigger enzyme
essential
no
ec
4.2.1.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.4|Trigger enzyme that acts by binding of a specific RNA element]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • Gene

    Coordinates
    1,926,680 → 1,929,409

    Phenotypes of a mutant

  • glutamate auxotrophy and a defect in sporulation [Pubmed|9393699]
  • The protein

    Catalyzed reaction/ biological activity

  • Citrate <=> isocitrate
  • Binding to iron responsive elements (IRE RNA) in the absence of the FeS cluster [Pubmed|23354745,10468622]
  • 2-methylaconitate --> 2-methyl-isocitrate in the methylcitric acid cycle [pubmed|28956599]
  • [SW|Cofactors]

  • FeS cluster [pubmed|29292548]
  • Structure

  • [PDB|2B3X] (the human enzyme, 53% identity) [pubmed|16407072]
  • Additional information

  • ''B. subtilis'' aconitase is both an enzyme and an RNA binding protein ([SW|moonlighting protein]) [Pubmed|10468622]
  • extensive information on the structure and enzymatic properties of CitB can be found at [http://www.proteopedia.org/wiki/index.php/Aconitase Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]-[gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1310745], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12591885], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [pubmed|10656796] [pubmed|12100558], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|12591885], indirect negative regulation by [protein|search|AbrB] [Pubmed|20817675]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|18697947]
  • Biological materials

    Mutant

  • GP1275 (Δ''citB''::''erm''), available in [SW|Jörg Stülke]'s lab
  • GP1441 (ΔcitB::spc), available in [SW|Jörg Stülke]'s lab
  • 1A999 (''citB''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A999&Search=1A999 BGSC]
  • GP2338 (Δ''[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]''::''kan''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2339 (Δ''[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]''::''lox72''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE18000 (Δ[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAG
  • BKK18000 (Δ[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAG
  • lacZ fusion

  • pGP700 (in [protein|search|pAC5]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1434 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1144 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • GP1145 (kan), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Linc Sonenshein]'s lab
  • Labs working on this gene/protein

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • References

    Reviews

  • 12732309,2696478,18261896,18086213
  • Original publications

  • 18697947,20097860,2118511,12850135,2413006,10656796,10468622,6143742,16395550,16923907,9642180,9393699,12591885,2105305,20933603,21099137,21446632,21821766,22389480,23139400,23354745,20817675,15378759,16923908,21744456,11992126,28956599,16407072