SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


DEAD-box RNA helicase, important for adaptation to low temperatures
57.11 kDa
protein length
511 aa Sequence Blast
gene length
1536 bp Sequence Blast
RNA helicase
DEAD-box RNA helicase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.3|DEAD-box RNA helicases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosome assembly]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    511,106 → 512,641

    Phenotypes of a mutant

  • poor growth at low temperatures (16 to 20°C) [Pubmed|23175651]
  • reduced number of [SW|ribosome]s [Pubmed|23175651]
  • no expression of the ''[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]'' operon [Pubmed|23175651]
  • strongly increased expression of the ''[gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]'' operon [Pubmed|23175651]
  • transcription profile resulting from ''[gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]'' depletion: [ GEO] [Pubmed|23175651]
  • The protein

    Catalyzed reaction/ biological activity

  • RNA helicase
  • required for [SW|ribosome] assembly (biogenesis of the large subunit) [Pubmed|23175651]
  • unwind duplex RNA with or without overhangs [pubmed|28238534]
  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • [SW|DEAD-box RNA helicases] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|DeaD], [protein|0362D937D985846AEE4D0DEA57B62F915E8D35E5|YfmL], [protein|C83BD80DE0FD187D07B914F64696438ED5130107|CshB]
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 34-204) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 215-375) (according to UniProt)
  • Structure

  • [PDB|5IVL] [Pubmed|28238534]
  • [SW|Localization]

  • cytoplasma, colocalizes with the ribosomes [Pubmed|16352840,27708634], may also associate with the cell membrane [Pubmed|20572937]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP1035 (Δ[gene|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|cshA]::aphA3), available in [SW|Jörg Stülke]'s lab [pubmed|23175651]
  • GP1083 (Δ[gene|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|cshA]::cat), available in [SW|Jörg Stülke]'s lab
  • BKE04580 (Δ[gene|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|cshA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC
  • BKK04580 (Δ[gene|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|cshA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1387, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1026 (aphA3), available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1386, available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • pGP1369 for chromosomal expression of CshA-YFP, available in [SW|Jörg Stülke]'s lab
  • ''B. subtilis'' GP1081 cshA-gfp spc, available in [SW|Jörg Stülke]'s lab,
  • GP1721 (in [SW|pBP43]), expression of '' cshA-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab [Pubmed|27708634]
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|20572937]
  • FLAG-tag construct

  • GP1010 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • GP1074 (tet), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [ homepage]
  • References


  • 22568516,29314657,19747077,25907111
  • Original publications

  • 20572937,23175651,21803996,16352840,27708634,27965645,28238534,30337909