SubtiBank SubtiBank
rapG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rapG

response regulator aspartate phosphatase, controls [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] activity
locus
BSU_40300
pI
4.81
mw
42.68 kDa
protein length
365 aa Sequence Blast
gene length
1098 bp Sequence Blast
function
control of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] activity
product
response regulator aspartate phosphatase
essential
no
synonyms
yycM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • Gene

    Coordinates
    4,140,260 → 4,141,357

    The protein

    Catalyzed reaction/ biological activity

  • control of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] activity [Pubmed|12950930]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Effectors of protein activity

  • binding of [protein|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|PhrG] to [protein|E1744329B6489F989F93F3E71E51E772E3926ABF|RapG] prevents it from binding [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] [Pubmed|12950930]
  • Structure

  • [PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF], 26% identity) [pubmed|23526880]
  • Expression and Regulation

    Operons

    genes
    [gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG]-[gene|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG]
    description
    [Pubmed|12950930]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16553878], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|12950930], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|16553878], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (4.8-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B821 (yycM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1820 NBRP B. subtilis, Japan]
  • BKE40300 (Δ[gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAACTCCTTTCTCT, downstream forward: _UP4_ATTAAACGAACGGAGGTTAT
  • BKK40300 (Δ[gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAACTCCTTTCTCT, downstream forward: _UP4_ATTAAACGAACGGAGGTTAT
  • References

  • 16553878,16430695,12950930,23526880