SubtiBank SubtiBank
yopO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yopO

similar to transcription regulator (Xre family)
locus
BSU_20820
pI
4.29
mw
7.81 kDa
protein length
gene length
213 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,207,748 → 2,207,960

    The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 5-59) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8B15C7311E9791DC1FF29FF1A46ECC70E93FE2F4|yopM]-[gene|01BE35FB190DDC77BE19C013A8E0D980B132CBE1|yopN]-[gene|E1B90896149DBA399174478D412DCDC242AB1834|yopO]-[gene|30D16B0061BBE33B6B53F219A6654A40F2185C53|yopP]-[gene|25F9A95D40FD5FA1114A1938D6B0DE2368B8689E|yopQ]-[gene|7F82DED7C941BC501B6F810BF6541780AB87EDDD|yopR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE20820 (Δ[gene|E1B90896149DBA399174478D412DCDC242AB1834|yopO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAACCTCCTATTTTT, downstream forward: _UP4_TTAGATGAGAAAGGAGGAGA
  • BKK20820 (Δ[gene|E1B90896149DBA399174478D412DCDC242AB1834|yopO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAACCTCCTATTTTT, downstream forward: _UP4_TTAGATGAGAAAGGAGGAGA
  • References

  • 23504016