SubtiBank SubtiBank
lytB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lytB

modifier protein of major autolysin [protein|6A21293823151C6980BF52B31A4B249A8440F2E1|LytC]
locus
BSU_35630
pI
9.84
mw
76.55 kDa
protein length
705 aa Sequence Blast
gene length
2118 bp Sequence Blast
function
autolysis
product
modifier protein of major autolysin [protein|6A21293823151C6980BF52B31A4B249A8440F2E1|LytC]
essential
no
synonyms
cwbA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,660,648 → 3,662,765

    The protein

    Structure

  • [PDB|4RWR] (B. anthracis [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID], corresponds to aa 414 ... 702) [pubmed|27226615]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]-[gene|E1F9922DF7273040F84E5AC207A9F4CAFB85DC75|lytB]-[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]
    description
    [Pubmed|1357079]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1357079], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|1357079], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: repression, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]: repression, (in complex with [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]) [Pubmed|20351052], in [regulon|920F91E748EE079FF864011D9052B073567C41E4|SlrR regulon]
  • view in new tab

    Biological materials

    Mutant

  • 1A789 ( ''lytB''::''kan''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A789&Search=1A789 BGSC]
  • BKE35630 (Δ[gene|E1F9922DF7273040F84E5AC207A9F4CAFB85DC75|lytB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATTTCAGGTTCCTCCC, downstream forward: _UP4_TGATTATTTTAGGATATAAC
  • BKK35630 (Δ[gene|E1F9922DF7273040F84E5AC207A9F4CAFB85DC75|lytB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATTTCAGGTTCCTCCC, downstream forward: _UP4_TGATTATTTTAGGATATAAC
  • References

  • 1355454,16306698,1357079,20351052,9158733,27226615