SubtiBank SubtiBank
yerA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yerA

similar to adenine desaminase
locus
BSU_06560
pI
5.82
mw
66.47 kDa
protein length
580 aa Sequence Blast
gene length
1743 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
3.5.4.2
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    713,664 → 715,406

    The protein

    Catalyzed reaction/ biological activity

  • adenine + H+ + H2O --> hypoxanthine + NH4+ (according to UniProt)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Modification

  • phosphorylation on Ser-399 [Pubmed|17218307]
  • Expression and Regulation

    Operons

    genes
    [gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]-[gene|BE1F7BA77CE8B6A1A2D22F31421C27F2E954816A|yerB]-[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A910 (yerA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/910 NBRP B. subtilis, Japan]
  • BKE06560 (Δ[gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACATACTCTCCTTTA, downstream forward: _UP4_TAAAATATAAAAGAGCAGGG
  • BKK06560 (Δ[gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACATACTCTCCTTTA, downstream forward: _UP4_TAAAATATAAAAGAGCAGGG
  • References

  • 17218307