SubtiBank SubtiBank
manA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

manA

mannose-6-phosphate isomerase, required for proper cell wall synthesis
locus
BSU_12020
pI
5.28
mw
35.85 kDa
protein length
315 aa Sequence Blast
gene length
948 bp Sequence Blast
function
mannose utilization
product
mannose-6-phosphate isomerase
essential
no
synonyms
yjdE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.9|Utilization of mannose]
  • Gene

    Coordinates
    1,274,692 → 1,275,639

    Phenotypes of a mutant

  • cells lose the characteristic rod shape typical of wild type ''B. subtilis'' cells and instead appear as elongated spheres, which are significantly larger than normal [Pubmed|20862359]
  • The protein

    Catalyzed reaction/ biological activity

  • D-mannose 6-phosphate --> D-fructose 6-phosphate (according to UniProt)
  • Protein family

  • mannose-6-phosphate isomerase type 1 family (with [protein|35225776F6044513D3E77DBBD6A7A8FE976F506A|GmuF] and [protein|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|Pmi], according to UniProt)
  • Paralogous protein(s)

  • [protein|35225776F6044513D3E77DBBD6A7A8FE976F506A|GmuF], [protein|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|Pmi]
  • Structure

  • [PDB|1QWR] ([protein|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|Pmi], 56% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]
    description
    [Pubmed|20139185]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20139185], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR]: activation, in the presence of mannose and absence of glucose [Pubmed|20139185], in [regulon|F273002AF97D87BB025B4F014C328C5592EAD621|ManR regulon]
  • [regulon|RNA switch|RNA switch]: termination/antitermination, expession may be controlled by a potential [SW|RNA switch] located in the 5' untranslated region of the [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF] mRNA between [gene|E26C70893C5D677C816C814558CC42F90B920087|manA] and [gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF], in [regulon|RNA switch|RNA switch]
  • regulation

  • induced by mannose ([protein|search|ManR]) [Pubmed|20139185]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A265 (yjdE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/265 NBRP B. subtilis, Japan]
  • BKE12020 (Δ[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTCGTCATGAAAATCCCCC, downstream forward: _UP4_TAACATGGCAGGGCTTGAGA
  • BKK12020 (Δ[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTCGTCATGAAAATCCCCC, downstream forward: _UP4_TAACATGGCAGGGCTTGAGA
  • References

  • 10960106,20139185,10627040,20862359,23033921,26238998