SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


mannose-6-phosphate isomerase, required for proper cell wall synthesis
35.85 kDa
protein length
315 aa Sequence Blast
gene length
948 bp Sequence Blast
mannose utilization
mannose-6-phosphate isomerase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of mannose]
  • Gene

    1,274,692 → 1,275,639

    Phenotypes of a mutant

  • cells lose the characteristic rod shape typical of wild type ''B. subtilis'' cells and instead appear as elongated spheres, which are significantly larger than normal [Pubmed|20862359]
  • The protein

    Catalyzed reaction/ biological activity

  • D-mannose 6-phosphate --> D-fructose 6-phosphate (according to UniProt)
  • Protein family

  • mannose-6-phosphate isomerase type 1 family (with [protein|35225776F6044513D3E77DBBD6A7A8FE976F506A|GmuF] and [protein|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|Pmi], according to UniProt)
  • Paralogous protein(s)

  • [protein|35225776F6044513D3E77DBBD6A7A8FE976F506A|GmuF], [protein|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|Pmi]
  • Structure

  • [PDB|1QWR] ([protein|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|Pmi], 56% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20139185], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR]: activation, in the presence of mannose and absence of glucose [Pubmed|20139185], in [regulon|F273002AF97D87BB025B4F014C328C5592EAD621|ManR regulon]
  • [regulon|RNA switch|RNA switch]: termination/antitermination, expession may be controlled by a potential [SW|RNA switch] located in the 5' untranslated region of the [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF] mRNA between [gene|E26C70893C5D677C816C814558CC42F90B920087|manA] and [gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF], in [regulon|RNA switch|RNA switch]
  • regulation

  • induced by mannose ([protein|search|ManR]) [Pubmed|20139185]
  • view in new tab

    Biological materials


  • MGNA-A265 (yjdE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12020 (Δ[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTCGTCATGAAAATCCCCC, downstream forward: _UP4_TAACATGGCAGGGCTTGAGA
  • BKK12020 (Δ[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTCGTCATGAAAATCCCCC, downstream forward: _UP4_TAACATGGCAGGGCTTGAGA
  • References

  • 10960106,20139185,10627040,20862359,23033921,26238998