SubtiBank SubtiBank
yjoB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yjoB

AAA family, ATPase activity , similar to cell-division protein [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH]
locus
BSU_12420
pI
4.73
mw
48.61 kDa
protein length
423 aa Sequence Blast
gene length
1272 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.9|Cell division/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    1,314,453 → 1,315,724

    The protein

    Protein family

  • [SW|AAA ATPase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH]
  • Structure

  • [PDB|1LV7] (AAA domain of E. coli [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH], correponds to aa 210 ... 400 of YjoB, 32% identity) [pubmed|12176385]
  • Expression and Regulation

    Operons

    genes
    [gene|E278CCD5CFD618A0D4ACB92E1E06DCC1B4570ED0|yjoB]
    description
    [Pubmed|1378051]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A031 (yjoB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/31 NBRP B. subtilis, Japan]
  • BKE12420 (Δ[gene|E278CCD5CFD618A0D4ACB92E1E06DCC1B4570ED0|yjoB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATACTCCATTTCA, downstream forward: _UP4_TAAAAGAAAGCACGGGTGTT
  • BKK12420 (Δ[gene|E278CCD5CFD618A0D4ACB92E1E06DCC1B4570ED0|yjoB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATACTCCATTTCA, downstream forward: _UP4_TAAAAGAAAGCACGGGTGTT
  • References

  • 14757246,1378051,9987136,12176385