SubtiBank SubtiBank
yydH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yydH

membrane protease, processing of modified [protein|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|YydF]
locus
BSU_40160
pI
9.64
mw
29.72 kDa
protein length
252 aa Sequence Blast
gene length
759 bp Sequence Blast
function
control of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]-[protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS] activity
product
membrane protease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,125,742 → 4,126,500

    The protein

    Catalyzed reaction/ biological activity

  • processing of modified [protein|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|YydF], results in mature peptide (residues 33-49) [pubmed|28644475]
  • Protein family

  • [SW|peptidase M50B family] (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|yydF]-[gene|25FC87037222084ABE318813959101016FEB49DF|yydG]-[gene|E280A5994F4D9D93DA4B698E79C86360DBEE5396|yydH]-[gene|1BF1A48CF645249CA9ECBB19C04B059B11D821EF|yydI]-[gene|A4213DE6C9BE29405B0A4C0A969A78EA4C5EB71F|yydJ]
    description
    [Pubmed|17921301]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17921301], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|17921301], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • activated after transition to stationary phase([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|17921301]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B809 (yydH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1808 NBRP B. subtilis, Japan]
  • BKE40160 (Δ[gene|E280A5994F4D9D93DA4B698E79C86360DBEE5396|yydH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTTTAAAATTTTC, downstream forward: _UP4_TAGAGTAAAAGATCTCCAAA
  • BKK40160 (Δ[gene|E280A5994F4D9D93DA4B698E79C86360DBEE5396|yydH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTTTAAAATTTTC, downstream forward: _UP4_TAGAGTAAAAGATCTCCAAA
  • References

    Reviews

  • 23106164
  • Original publications

  • 10092453,17921301,15743949,17921301,21815947,23199363,28644475