SubtiBank SubtiBank
yydH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yydH

membrane protease, processing of modified [protein|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|YydF]
locus
BSU_40160
pI
9.64
mw
29.72 kDa
protein length
252 aa Sequence Blast
gene length
759 bp Sequence Blast
function
control of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]-[protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS] activity
product
membrane protease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,125,742 → 4,126,500

    The protein

    Catalyzed reaction/ biological activity

  • processing of modified [protein|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|YydF], results in mature peptide (residues 33-49) [pubmed|28644475]
  • Protein family

  • [SW|peptidase M50B family] (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|yydF]-[gene|25FC87037222084ABE318813959101016FEB49DF|yydG]-[gene|E280A5994F4D9D93DA4B698E79C86360DBEE5396|yydH]-[gene|1BF1A48CF645249CA9ECBB19C04B059B11D821EF|yydI]-[gene|A4213DE6C9BE29405B0A4C0A969A78EA4C5EB71F|yydJ]
    description
    [Pubmed|17921301]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17921301], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|17921301], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • activated after transition to stationary phase([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|17921301]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B809 (yydH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1808 NBRP B. subtilis, Japan]
  • BKE40160 (Δ[gene|E280A5994F4D9D93DA4B698E79C86360DBEE5396|yydH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTTTAAAATTTTC, downstream forward: _UP4_TAGAGTAAAAGATCTCCAAA
  • BKK40160 (Δ[gene|E280A5994F4D9D93DA4B698E79C86360DBEE5396|yydH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTTTAAAATTTTC, downstream forward: _UP4_TAGAGTAAAAGATCTCCAAA
  • References

    Reviews

  • 23106164
  • Original publications

  • 10092453,17921301,15743949,17921301,21815947,23199363,28644475