SubtiBank SubtiBank
bceB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

bceB

primary bacitracin resistance determinant, [SW|ABC transporter] (permease), sensory component of the Bce regulatory & detoxification system, protects cell wall biosynthetic targets from inhibition by antimicrobial peptides
locus
BSU_30370
pI
9.79
mw
72.01 kDa
protein length
646 aa Sequence Blast
gene length
1941 bp Sequence Blast
function
protection of cell wall biosynthetic targets from inhibition by antimicrobial peptides
product
[SW|ABC transporter] for target protection of cell wall synthesis
essential
no
synonyms
ytsD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.3|Export of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,109,397 → 3,111,337

    Phenotypes of a mutant

  • 85-fold increased sensitivity to bacitracin [Pubmed|26815905]
  • The protein

    Catalyzed reaction/ biological activity

  • binds bacitracin, KD: 60 nM [Pubmed|25118291]
  • inhibits [protein|08F24CA21DC54031F6158AC0C772F3B520E5A849|BceS] autophosphorylation activity in the absence of bacitracin [Pubmed|25118291]
  • releaves intermediates of the lipid II cycle from the inhibitory interaction with antimicrobial peptides such as bacitracin [pubmed|31871088]
  • Protein family

  • [SW|ABC-4 integral membrane protein family] (according to UniProt)
  • Effectors of protein activity

  • the activity of the [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|BceA]-[protein|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|BceB] [SW|ABC transporter] is inhibited by heptaprenyl pyrophosphate which accumulates in a ''[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]'' mutant [Pubmed|24806199]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]-[gene|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|bceB]
    description
    [Pubmed|12890034]

    regulatory mechanism

  • [protein|C239C155F5452C86BF6C78190BABBBB07A63DF87|BceR]: activation, [Pubmed|12890034], in [regulon|C239C155F5452C86BF6C78190BABBBB07A63DF87|BceR regulon]
  • regulation

  • induced in the presence of bacitracin, plectasin, mersacidin and actagardine, already at very low levels of bacitracin ([protein|search|BceR]) [Pubmed|12890034,26815905]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A168 (ytsD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/168 NBRP B. subtilis, Japan]
  • BKE30370 (Δ[gene|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|bceB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG
  • BKK30370 (Δ[gene|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|bceB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG
  • labs

  • [SW|Susanne Gebhard], Bath, UK
  • References

    Reviews

  • 27344142,28152228,29404338
  • Original publications

  • 18394148,17905982,12890034,14651641,10092453,14612242,21283517,20606066,21078927,23687272,25118291,24806199,26199330,26815905,31871088,32019833