SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glutamine transporter (proton symport)
49.83 kDa
protein length
478 aa Sequence Blast
gene length
1437 bp Sequence Blast
glutamine uptake
glutamine transporter (proton symport)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Solute:sodium symporter family]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Alanine or glycine cation symporter family]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    262,732 → 264,168

    The protein

    Protein family

  • [SW|Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|AlsT], [protein|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|YflA], [protein|A10EA56A7EDA2DF712B5BB87D94A818E39940B44|YrbD]
  • Structure

  • [PDB|6CSE] (from Methanococcus maripaludis), 37.4% identity [pubmed|30659158]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15995196], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL]: activation, [Pubmed|15995196], in [regulon|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL regulon]
  • regulation

  • induced in the presence of glutamine ([protein|search|GlnL]) [Pubmed|15995196]
  • view in new tab

    Biological materials


  • GP3503 (Δ[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::kan), available in [SW|Jörg Stülke]'s lab
  • MGNA-B942 ([gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02420 (Δ[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCACCTCTTTTTT, downstream forward: _UP4_TAAGAAAAGGGTGTTCAGAC
  • BKK02420 (Δ[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCACCTCTTTTTT, downstream forward: _UP4_TAAGAAAAGGGTGTTCAGAC
  • References

  • 15995196,30659158