SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


Carbon catabolite control protein A, involved in glucose regulation of many genes; represses catabolic genes and activates genes involved in excretion of excess carbon
36.78 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
carbon catabolite repression (CCR)
transcriptional regulator ([SW|LacI family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    3,044,165 → 3,045,169

    Phenotypes of a mutant

  • Loss of carbon catabolite repression. Loss of [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI]-dependent sugar transport due to excessive phosphorylation of [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK]
  • The mutant is unable to grow on a minimal medium with glucose and ammonium as the only sources of carbon and nitrogen, respectively, this can be suppressed by mutations resulting in hyperactive [protein|41199C76DF8CA804B7B8878D61228B9542A96AE4|topoisomerase I] or in the inactivation of [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [pubmed|29242163,17183217]
  • The protein

    Catalyzed reaction/ biological activity

  • transcriptional regulator of carbon catabolite repression (CCR)
  • Protein family

  • [SW|LacI family]
  • [SW|Domains]

  • [SW|HTH lacI-type domain] (aa 1-58) (according to UniProt)
  • DNA binding Domain (6 – 25)
  • [SW|Cofactors]

  • [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]-Ser46-P, [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh]-Ser-46-P
  • Effectors of protein activity

  • glucose-6-phosphate, fructose-1,6-bisphosphate [Pubmed|17376479]
  • Structure

  • [PDB|3OQM] (complex of ''B. subtilis'' CcpA with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the ''[gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]'' operator site)
  • [PDB|3OQN] (complex of ''B. subtilis'' CcpA with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the ''[gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]'' operator site)
  • [PDB|3OQO] (complex of ''B. subtilis'' CcpA with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and a optimal synthetic operator site)
  • [PDB|2HSG] (apoprotein) [pubmed|17500051]
  • CcpA-[protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh]-DNA-complex [ NCBI]
  • complex with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and sulphate ions [ NCBI]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive
  • view in new tab

    additional information

  • there are about 3.000 molecules of CcpA per cell [ PubMed], this corresponds to a concentration of 3 µM (according to [PubMed|20408793])
  • Biological materials


  • QB5407 (ccpA::spc) [Pubmed|10941796], available in [SW|Jörg Stülke]'s lab
  • GP302 (erm) [Pubmed|12123463], available in [SW|Jörg Stülke]'s lab
  • GP300 (an in frame deletion of ''[gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]'') [Pubmed|11557150], available in [SW|Jörg Stülke]'s lab
  • WH649 (aphA3), available in [SW|Gerald Seidel]'s lab
  • BKE29740 (Δ[gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAAAACCACTCCTTT, downstream forward: _UP4_TAAGAAAAACAAAGAGCAAG
  • BKK29740 (Δ[gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAAAACCACTCCTTT, downstream forward: _UP4_TAAGAAAAACAAAGAGCAAG
  • Expression vectors

  • pGP643 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • pWH940 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Gerald Seidel]'s lab
  • Antibody

  • available in [SW|Gerald Seidel]'s and in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Gerald Seidel], Erlangen University, Germany [ Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [ Homepage]
  • [SW|Milton H. Saier], University of California at San Diego, USA [ Homepage]
  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • [SW|Oscar Kuipers], University of Groningen, The Netherlands [ Homepage]
  • References


  • 20408793,8598282,19202299,14665673,18628769,18359269
  • General and physiological studies

  • 1904524,10941796,12123463,8000527,18757537,16547058,14523131,22001508,22512862,29242163,30096425
  • Global analyses (proteome, transcriptome, ChIP-chip)

  • 12850135,11251851,10559165,11160890,17183215,22383848,22900538,26483775
  • Repression of target genes by CcpA

  • 15150224,16166551,11929549,7913927,17827291,11985717,12100558,7592486,16825793,16491025,21398533,26712933,28974613
  • Positive regulation of gene expression by CcpA

  • 8226682,12193635,10559153,15916605,9811655,10986270,25157083
  • Control of CcpA activity

  • 7623661,9973552,9334231,12051938,9689125
  • CcpA-DNA interaction

  • 8596444,10666464,15885105,7665492,9254709,21106498
  • Functional analysis of CcpA

  • 10383986,10601226,11557150,9252590,9988473
  • Structural analyses

  • 15369672,16316990,17376479,16755587,17500051,17401189,10666630