SubtiBank SubtiBank
ppsA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ppsA

plipastatin synthetase
locus
BSU_18340
pI
5.22
mw
288.86 kDa
protein length
2561 aa Sequence Blast
gene length
7686 bp Sequence Blast
function
production of the antibacterial compound plipastatin
product
plipastatin synthetase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    1,990,272 → 1,997,957

    The protein

    Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|Carrier domain]s (aa 961-1036, aa 2007-2081) (according to UniProt)
  • Structure

  • [PDB|2VSQ] (termination module of [protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|SrfAC], 30% identity) [pubmed|18583577]
  • Expression and Regulation

    Operons

    genes
    [gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]-[gene|E7A2F93B33B1899313893D362D92405232BC9097|ppsB]-[gene|D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407|ppsC]-[gene|E73D9F1A8F54DAD4B2056CABBE580D7AD36CB042|ppsD]-[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE18340 (Δ[gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGATTCCCTCCAGTTC, downstream forward: _UP4_TAACTTTTGAAAAGGTGTGT
  • BKK18340 (Δ[gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGATTCCCTCCAGTTC, downstream forward: _UP4_TAACTTTTGAAAAGGTGTGT
  • References

  • 10471562,9387222,20817675,18583577