SubtiBank SubtiBank
ydbS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydbS

resistence against antimicrobial compounds from B. amyloliquefaciens
locus
BSU_04590
pI
8.13
mw
17.98 kDa
protein length
159 aa Sequence Blast
gene length
480 bp Sequence Blast
function
confers resistence against antimicrobial compounds from B. amyloliquefaciens
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    512,814 → 513,293

    The protein

    Protein family

  • UPF0699 family (with [protein|15CD9023540E3BB7D3EC8A60E204052DD256CE9F|YdbT], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E4139214AB491712309F84A0792BCD8939F634D7|ydbS]-[gene|15CD9023540E3BB7D3EC8A60E204052DD256CE9F|ydbT]
    description
    [Pubmed|11866510]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C100 (ydbS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2098 NBRP B. subtilis, Japan]
  • BKE04590 (Δ[gene|E4139214AB491712309F84A0792BCD8939F634D7|ydbS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATACCTACCTCCCTT, downstream forward: _UP4_TCCCGTCTGGCGAGGGTGAC
  • BKK04590 (Δ[gene|E4139214AB491712309F84A0792BCD8939F634D7|ydbS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATACCTACCTCCCTT, downstream forward: _UP4_TCCCGTCTGGCGAGGGTGAC
  • References

  • 16629676,12207695,11866510