SubtiBank SubtiBank
hemH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hemH

coproporphyrin ferrochelatase
locus
BSU_10130
pI
4.62
mw
35.19 kDa
protein length
310 aa Sequence Blast
gene length
933 bp Sequence Blast
function
biosynthesis of heme
product
coproporphyrin ferrochelatase
essential
no
ec
4.99.1.1
synonyms
hemF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • Gene

    Coordinates
    1,087,250 → 1,088,182

    The protein

    Catalyzed reaction/ biological activity

  • coproporphyrin --> coproheme [pubmed|25646457]
  • 2 H+ + heme b --> Fe2+ + protoporphyrin IX (according to UniProt)
  • Protein family

  • ferrochelatase family (with [protein|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|YlnF], according to UniProt)
  • Structure

  • [PDB|2HK6] (complex with iron) [pubmed|17198378]
  • [PDB|1AK1] [pubmed|9384565]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|762E7731EFEAC9F38074D7A7E9A3E5759437CDCA|hemE]-[gene|E4C588EC93132CCBE4F40559F8A480A66A2D82D7|hemH]-[gene|7541AD7D06BC4CE30AD576562E0053CC1E25B4D6|hemY]
    description
    [Pubmed|1459957]
    view in new tab

    Biological materials

    Mutant

  • BKE10130 (Δ[gene|E4C588EC93132CCBE4F40559F8A480A66A2D82D7|hemH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTTTACACCCTCTTTA, downstream forward: _UP4_GGACGTTAAAGAAGGCGATG
  • BKK10130 (Δ[gene|E4C588EC93132CCBE4F40559F8A480A66A2D82D7|hemH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTTTACACCCTCTTTA, downstream forward: _UP4_GGACGTTAAAGAAGGCGATG
  • References

    Reviews

  • 28123057
  • Original Publications

  • 9384565,1459957,8119288,21052751,23097001,16453119,25826316,28864672,17198378,9384565,12761666,10704318,25646457