SubtiBank SubtiBank
yflP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yflP

unknown, putative binding protein, may control [protein|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|CitS] activity
locus
BSU_07600
pI
5.83
mw
29.11 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    833,228 → 834,187

    The protein

    Catalyzed reaction/ biological activity

  • putative binding protein, may control [protein|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|CitS] activity [Pubmed|14499931]
  • Protein family

  • UPF0065 (bug) family (single member, according to UniProt)
  • Structure

  • [PDB|4X9T] (from Polaromonas sp., 24% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|citS]-[gene|1345FBA88CB55E0E897FEC8DA4D829B85A8393BB|citT]-[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]
    description
    [Pubmed|10972810]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C251 (yflP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2249 NBRP B. subtilis, Japan]
  • BKE07600 (Δ[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGGATTATAGATTTTTTCA, downstream forward: _UP4_TAAAATCCCGACATCCCGGG
  • BKK07600 (Δ[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGGATTATAGATTTTTTCA, downstream forward: _UP4_TAAAATCCCGACATCCCGGG
  • References

    Reviews

  • 28152228
  • Original publications

  • 10972810,14499931