SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional regulator of transition state genes
10.63 kDa
protein length
gene length
291 bp Sequence Blast
regulation of gene expression during the transition from growth to stationary phase
transcriptional regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    44,848 → 45,138

    Phenotypes of a mutant

  • No swarming motility on B medium [Pubmed|19202088]
  • The protein

    Paralogous protein(s)

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT], [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]
  • [SW|Domains]

  • [SW|SpoVT-AbrB domain] (aa 7-52) (according to UniProt)
  • Modification

  • phosphorylated on Ser-86 [Pubmed|20509597] by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC], [protein|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|PrkD], and [protein|E86A96B832351FF513DD9853EAD8998CC44C9951|YabT] results in loss of DNA-binding activity [Pubmed|24731262]
  • Effectors of protein activity

  • interaction with [protein|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|AbbA] results in inactivation of AbrB [Pubmed|18840696]
  • Structure

  • [PDB|1Z0R] (N-terminal DNA recognition domain), [Pubmed|16223496]
  • [PDB|2MJG] (full-length protein) [Pubmed|25308864]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3145384], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, -P [Pubmed|3145384], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|2504584], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed at the onset of stationary phase [Pubmed|3145384]
  • additional information

  • degradation of the ''[SW|abrB]'' mRNA is triggered by base-pairing with [SW|RnaC] [Pubmed|25790031]
  • view in new tab

    Biological materials


  • TT731 (aphA3)
  • 1A935 (''abrB''::''cat''), [Pubmed|11886552], available at [ BGSC]
  • GP1548 (''abrB''::''ermC''), available in [SW|Stülke] lab
  • BKE00370 (Δ[gene|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTCCCAAGAGATA, downstream forward: _UP4_TAATCATTTCTTGTACAAAA
  • BKK00370 (Δ[gene|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTCCCAAGAGATA, downstream forward: _UP4_TAATCATTTCTTGTACAAAA
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Stülke] lab
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • [SW|Mark Strauch], Baltimore, USA [ homepage]
  • References


  • 11964117,19995980,11931565,19202088,18326573,28886686
  • The [SW|AbrB regulon]

  • 20817675,18840696,23580539
  • Other original publications

  • 19581368,2437099,8878039,11377867,1850083,12586407,2554317,18430133,7768874,2507867,1766371,15687200,1908787,2106683,15687200,2504584,3145384,8821944,8576231,11101897,11395475,11583849,11751836,12123659,12076816,12591885,15610005,16223496,16159768,16702211,17660417,17720793,7592460,19465659,20509597,15101989,19202088,18326573,24534728,24731262,24832089,25002359,25308864,25381239,25790031,30356068,30808982,30980290,32949815