SubtiBank SubtiBank
yjgC

yjgC

general stress protein, formate dehydrogenase, important for survival of salt and ethanol stress
locus
BSU_12160
pI
5.18
mw
109.58 kDa
protein length
985 aa Sequence Blast
gene length
2958 bp Sequence Blast
function
unknown
product
formate dehydrogenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    1,285,591 → 1,288,548

    The protein

    Protein family

  • C-terminal part: [SW|prokaryotic molybdopterin-containing oxidoreductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A4304213CFC152B601B2EED2B9B3A0A3AB4E6A81|YrhE]
  • [SW|Domains]

  • 2Fe-2S ferredoxin-type domain (aa 3-79) (according to UniProt)
  • 4Fe-4S His(Cys)3-ligated-type domain (aa 79-119) (according to UniProt)
  • 2 [SW|4Fe-4S ferredoxin-type domain]s (aa 139-170, aa 182-211) (according to UniProt)
  • [SW|4Fe-4S Mo/W bis-MGD-type domain] (aa 258-314) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|2FUG] (from Thermus thermophilus, 23% identity) [pubmed|16469879]
  • Expression and Regulation

    Operons

    genes
    [gene|E54F39E72DC4881E886159607C2B424A41DE0D01|yjgC]-[gene|01C43D05A53BF4B0F505D9C9CCAAFA1AF9E94F87|yjgD]
    description
    [Pubmed|11544224]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|11544224,15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A354 (yjgC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/354 NBRP B. subtilis, Japan]
  • BKE12160 (Δ[gene|E54F39E72DC4881E886159607C2B424A41DE0D01|yjgC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCATTCCCCTTTCTT, downstream forward: _UP4_GCTGTGAAAAGGGGGATGGG
  • BKK12160 (Δ[gene|E54F39E72DC4881E886159607C2B424A41DE0D01|yjgC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCATTCCCCTTTCTT, downstream forward: _UP4_GCTGTGAAAAGGGGGATGGG
  • References

  • 15805528,11544224,16469879