SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


farnesyl diphosphate phosphatase, production of farnesol
31.35 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
control of [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC] activity
farnesyl diphosphate phosphatase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of isoprenoids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • Gene

    1,159,922 → 1,160,746

    Phenotypes of a mutant

  • complete loss of pellicle-forming ability [Pubmed|20713508]
  • reduced [SW|protein secretion] [Pubmed|23651456]
  • The protein

    Catalyzed reaction/ biological activity

  • farnesyl diphosphate -→ farnesol [Pubmed|25308276]
  • Protein family

  • phytoene/squalene synthase family (single member, according to UniProt)
  • [SW|Cofactors]

  • NADH [Pubmed|20713508]
  • Structure

  • [PDB|3WE9] [Pubmed|25308276]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials


  • MGNA-B190 (yisP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10810 (Δ[gene|E5F32D960F6FF50A7B0E4B268D2296FE1A291512|yisP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCTTCTTCAAGTCTAG, downstream forward: _UP4_TAAAAAACACCCGGCCTTGA
  • BKK10810 (Δ[gene|E5F32D960F6FF50A7B0E4B268D2296FE1A291512|yisP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCTTCTTCAAGTCTAG, downstream forward: _UP4_TAAAAAACACCCGGCCTTGA
  • References


  • 25457121,25652542
  • Original publications

  • 20713508,19935659,23651456,23295493,25308276,26577401