SubtiBank SubtiBank
yhxA

yhxA

similar to adenosylmethionine-8-amino-7-oxononanoate aminotransferase
locus
BSU_09260
pI
5.64
mw
49.71 kDa
protein length
450 aa Sequence Blast
gene length
1350 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,000,364 → 1,001,716

    The protein

    Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|13DC4296015A28975BC7697F134FB6ECD6B11489|YodT]:
  • [protein|68C86FED3575B864C576DFB73FE7B5BF83994D1F|BioA]:
  • [protein|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|GabT]:
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3N5M] (from ''Bacillus Anthracis'', 64% identity)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|yhxA]-[gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]
    description
    [Pubmed|2127799]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21925382], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • half-life of the mRNA: 3.7 min [PubMed|21925382]
  • half-life of the mRNA: 3.7 min [PubMed|21925382]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B475 (yhxA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1474 NBRP B. subtilis, Japan]
  • BKE09260 (Δ[gene|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|yhxA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTAGCGTTCCCTA, downstream forward: _UP4_TAATATAAAAGTGAATTATT
  • BKK09260 (Δ[gene|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|yhxA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTAGCGTTCCCTA, downstream forward: _UP4_TAATATAAAAGTGAATTATT
  • References

  • 17981983,2127799,21925382