SubtiBank SubtiBank
yhxA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhxA

similar to adenosylmethionine-8-amino-7-oxononanoate aminotransferase
locus
BSU_09260
pI
5.64
mw
49.71 kDa
protein length
450 aa Sequence Blast
gene length
1350 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,000,364 → 1,001,716

    The protein

    Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|13DC4296015A28975BC7697F134FB6ECD6B11489|YodT]:
  • [protein|68C86FED3575B864C576DFB73FE7B5BF83994D1F|BioA]:
  • [protein|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|GabT]:
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3N5M] (from ''Bacillus Anthracis'', 64% identity)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|yhxA]-[gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]
    description
    [Pubmed|2127799]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21925382], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • half-life of the mRNA: 3.7 min [PubMed|21925382]
  • half-life of the mRNA: 3.7 min [PubMed|21925382]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B475 (yhxA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1474 NBRP B. subtilis, Japan]
  • BKE09260 (Δ[gene|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|yhxA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTAGCGTTCCCTA, downstream forward: _UP4_TAATATAAAAGTGAATTATT
  • BKK09260 (Δ[gene|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|yhxA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTAGCGTTCCCTA, downstream forward: _UP4_TAATATAAAAGTGAATTATT
  • References

  • 17981983,2127799,21925382